GENETH’OFF

Installation

In order to get a working environment, we recommend to clone the git repository :

git clone https://github.com/gcorre/GENETHOFF

Your folder architecture should look similar to :

GENETHOFF
├── 00-pipeline/
├── 01-envs/
├── 02-resources/
├── 03-misc/
├── test_dataset/

Conda environments

Install the miniconda environment manager :

## https://www.anaconda.com/docs/getting-started/miniconda/install

wget https://repo.anaconda.com/miniconda/Miniconda3-latest-Linux-x86_64.sh

bash ~/Miniconda3-latest-Linux-x86_64.sh

source ~/.bashrc

conda update -n base -c conda-forge conda

conda install mamba -c conda-forge # faster packages manager, if libmamba not already in your conda distribution

Install the workflow manager snakemake in the base environment

conda activate 
mamba install snakemake openpyxl # worflow manager 

Create the environment in your favorite path (-p) from the environment.yaml file:

cd GENETHOFF/

mamba env create -f 01-envs/environment.yml

Install the latex dependencies for PDF report generation:

# install tinytex dependencies
# If already installed but pdf report generation failed, reinstall setting force = TRUE
conda run -n GENETHOFF Rscript -e "tinytex::install_tinytex(force = FALSE)"

You should now have an environment named ‘GENETHOFF’ containing all the required programs when running:

#list environments
mamba env list 

# programs version in GENETHOFF environment
mamba list -n GENETHOFF

Reference genomes

The pipeline uses the bowtie2 program to align reads on the reference genome (@langmead2018).

For efficient genome alignment, you can use a pre-built index for Bowtie2. These indices can be downloaded from the Bowtie2 website. Using a pre-built index saves computational resources and time, as it eliminates the need to build the index from scratch.

Build index manually

If you decide to build the index, we recommend to not use haplotypes, scaffolds and unplaced chromosomes to avoid unnecessary multihits alignments. Instead, use the “primary Assembly” version from ensembl or gencode for example. Manually remove unwanted chromosomes if necessary using the seqkit program:

conda activate guideseq # load the 'GENETHOFF' environment to access tools

# keep only chromosomes, dicard scaffolds
seqkit grep  -r -p '^[chr]?[0-9XYM]+' Homo_sapiens.GRCh38.dna.primary_assembly.fa > your_clean_fasta

Then use the bowtie2 command line:

bowtie2-build -@ {threads} {your_clean_fasta} {index_prefix}

conda activate           # return to "base" environment

The index prefix path will be used in the configuration file.

Annotation

Genes

Off-Target site annotation is performed from a GTF file that can be downloaded from any source (ensembl, gencode …). The GTF file will be processed to keep only gene and exon features for annotation.

Both the GTF and fasta reference files should be downloaded from the same source for compatibility (especially in chromosome naming).

Oncogenes

Off-targets sites can be annotated with an oncogene list if provided in the configuration file, otherwise, NA will be added.

We provide an example in the 02-ressources/ folder. This file is derived from the oncoKB cancer gene list. A script is also available in 03-misc to convert file downloaded from oncoKB website to compatible file format.

User can provide its own annotation file but it must contain the following columns separated by tabs:

  • Ensembl transcript ID (ie ENST00000318560, without version)

  • Onco_annotation (collapsed strings, ex : “oncogene | TSG”)

Prediction tool

The pipeline uses the SWOffinder program (@yaish2024) to predict gRNA off-targets on the fly and annotate OT accordingly as predicted or not.

Running the pipeline

In order to run the analysis, 4 elements are mandatory:

  1. The conda environment (see above for installation)
  2. The Sample Data Sheet
  3. The configuration file
  4. The input un-demultiplexed reads in fastq.gz format (R1,R2,I1,I2). If working with libraries that were already demultiplexed, please read section Working with already demultiplexed libraries.

Prepare samples data sheet (SDS)

The sample data-sheet (SDS) is a simple file provided as delimited ( ; ) or xlsx format that contains information about each sample to process in the run. An example is proposed in ./test_dataset/sampleInfo.csv and``./test_dataset/sampleInfo.xlsx.

Mandatory columns are:
sampleName CellType Genome gRNA_name gRNA_sequence orientation Cas PAM_sequence PAM_side Cut_Offset type index1 index2 path_to_files
VEGFA_s1_K562_pos K562 GRCh38 VEGFAs1 GGGTGGGGGGAGTTTGCTCC positive Cas9 NGG 3 -4 guideseq AGGCAGAA CTAAGCCT ./my_folder1/
VEGFA_s1_K562_neg K562 GRCh38 VEGFAs1 GGGTGGGGGGAGTTTGCTCC negative Cas9 NGG 3 -4 guideseq TCCTGAGC CTAAGCCT ./my_folder2/
  • sampleName : Sample name to use.
    • Will be use to name output files and folders.
    • Samples with the same sampleName will be merged before processing (Merging samples)
    • Samples name must not include ‘-’ in their name as this symbol is used in the pipeline for a special purpose. Instead, use “_” or any other separator of your choice.
  • Genome: Uses to define which reference genome to use for each sample.
    • This must be one of the values present in config file genome key (see Reference genome).
  • gRNA_name : name of the gRNA used.
  • gRNA_sequence: Sequence of the gRNA without the PAM sequence.
  • orientation : which PCR orientation was chosen [“positive”, “negative”, “mix” if they share the same indexes]
    • (this info is only used for metadata purposes, both PCR orientations are automatically processes by the pipeline).
  • Cas: name of the Cas used
  • PAM_sequence: Sequence of the PAM
  • PAM_side: [5 or 3] indicating if the PAM is 5’ or 3’
  • Cut_Offset: Distance from gRNA end where the cut occurs [default : -4]
  • type: Type of experiment [“guideseq”, “iguideseq”] or other. This value will define which sequence to trim (Reads adapter & ODN trimming sequences). Type of library in the SDS file must match one identical type in the configuration file.
  • index1: Sequence of index 1 for demultiplexing
  • index2: Sequence of index 2 for demultiplexing
  • path_to_files : If skipping demultiplexing, path to folder containing R1 and R2 reads.

Additional columns can be added for metadata annotation purpose.

SDS format is automatically validated using the snakemake.utils - validate function.

Merging samples

In certain scenarios, it may be beneficial to merge different samples from a library during the reads processing stage. This can be particularly useful when dealing with Multiple Replicates or +/-PCR orientations.

To achieve this, you can use the same sample name for multiple rows in the Sample Description Sheet (SDS). Samples that share the same name will be merged during the reads processing, provided they meet the following criteria:

  1. Reference Genome: The samples must use the same reference genome.

  2. gRNA: The samples must have the same gRNA, both in terms of sequence and name.

  3. Cas Protein: The samples must use the same Cas protein, with identical PAM (Protospacer Adjacent Motif) and Offset values.

  4. Protocole: The samples must use the same ODN (Oligodeoxynucleotide), defined as guideseq or iguideseq.

If any of the above conditions are not met, an error will be raised, and the pipeline will be stopped. This ensures that only compatible samples are merged, maintaining the integrity of the data processing workflow.

Using the test SDS above, if you want to merge both positive and negative libraries, give the same sample name to both rows. As they use the same genome, gRNA, Cas & method, they will be aggregated in a single library.

UMI and reads counts will still be breakdown to each PCR orientation in the final result table.
sampleName CellType Genome gRNA_name gRNA_sequence orientation Cas PAM_sequence PAM_side Cut_Offset type index1 index2
VEGFA_s1_K562 K562 GRCh38 VEGFAs1 GGGTGGGGGGAGTTTGCTCC positive Cas9 NGG 3 -4 guideseq AGGCAGAA CTAAGCCT
VEGFA_s1_K562 K562 GRCh38 VEGFAs1 GGGTGGGGGGAGTTTGCTCC negative Cas9 NGG 3 -4 guideseq TCCTGAGC CTAAGCCT

Working with already demultiplexed libraries

In configuration file, set :

skip_demultiplexing: "TRUE"

If working with already demultiplexed libraries, we still need to get UMIs in order to perform the quantification.

The following approach is used here:

  • For each sample :

    • Check that R1 and R2 are present in the folder defined in the sample datasheet column 'path_to_files'.Each sample may be in a different folder, or not.

      • Also check if I2 is present (contains barcode2 and UMI sequences).

      • I1 is not required as demultiplexing was already performed.

    • Create a symlink from R1, R2 and I2 files (if present) to 00-demultiplexing/

      • Do not move your raw files to 00-demultiplexing/ !!

      • This folder is deleted after processing.

    • If I2 is present, the pipeline will proceed normally as required files (symlinks) are present in the 00-demultiplexed/ folder.

    • If I2 is missing, the pipeline creates it from R2 reads header using the conversion script located in 03-misc/extract_I2_from_header.py and proceed normally.

For this last option, it means that R2 reads must contains the indexes in their header, as generated by NGS platforms during automatic demultiplexing :

Example R2 reads :

@M02111:194:000000000-LT722:1:1101:16107:1339 2:N:0:TCCTGAGC+CTAAGCCTAATTCAGC
TTGAGTTGTCATATGTTAATAACGGTATAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGCTGAATTAGGCTTAGG
+
>ABBCFFFFFFFGGGGGFGGGGHGGGHGHHGHGHGGGGHHHGGGGEEGHHHGHGGHHHGH5D5GAFGHGHGGHBGBFF
...
...
(continued)

The missing I2 files will be reconstructed from the R2 files, replacing the reads sequence by the index sequence present in the header (between “+” and end of line). Quality track is composed of “I” only :

Generated I2 reads:

@M02111:194:000000000-LT722:1:1101:16107:1339 2:N:0:TCCTGAGC+CTAAGCCTAATTCAGC
CTAAGCCTAATTCAGC
+
IIIIIIIIIIIIIIII
...
...
(continued)

Prepare the configuration file

The configuration file is a yaml formatted file with key-value dictionary used to fine-tune the pipeline behavior. Settings will apply to all samples of the run.

An example of configuration file is proposed in ./test_dataset/configuration.yml

config file must be present in the working directory when starting the pipeline.

Metadata

Author and affiliation will be printed on the final report.

author: "Guillaume CORRE, PhD"
affiliation: "Therapeutic Gene Editing - GENETHON, INSERM U951, Paris-Saclay University, Evry, France"
contact: "gcorre@genethon.fr"
version: 'V1.1'

Remove intermediate files

Whether to remove all intermediate files after run completion.

clean_intermediates_files: 'TRUE'

skip_demultiplexing: "FALSE"

Path to Sample Data Sheet and read files

SDS path is relative to current folder (from where the pipeline is started). Absolute path can be used.

If demultiplexing is skipped, R1, R2, I1 and I2 reads will not be used. Path to samples must be indicated in the sample datasheet column 'path_to_files'.

## Library informations
sampleInfo_path: "sampleInfo.csv"

read_path: "."  # path to reads if not current folder
R1: "Undetermined_S0_L001_R1_001.fastq.gz"
R2: "Undetermined_S0_L001_R2_001.fastq.gz"
I1: "Undetermined_S0_L001_I1_001.fastq.gz"
I2: "Undetermined_S0_L001_I2_001.fastq.gz"

Reference genome

Genome name is user-defined but must be referenced using the exact same name in the Sample Data Sheet.

‘Index’ corresponds to the prefix used when bowtie2 index was built (Build index manually).

## path to references
genome:
  GRCh37:
    fasta: "/PATH_TO_REFERENCE/GRCh37/Sequences/GRCh37.primary_assembly.genome.fa"
    index: "/PATH_TO_REFERENCE/GRCh37/Indexes/Bowtie2/GRCh37.primary_assembly.genome" 
    annotation: "/PATH_TO_REFERENCE/GRCh37/Annotations/gencode.v19.annotation.gtf.gz"
  GRCh38:
    fasta: "/PATH_TO_REFERENCE/GRCh38/Sequences/GRCh38.primary_assembly.genome.fa"
    index: "/PATH_TO_REFERENCE/GRch38/Indexes/Bowtie2/GRCh38.primary_assembly.genome" 
    annotation: "/PATH_TO_REFERENCE/GRCh38/Annotations/gencode.v46.annotation.gtf.gz"
    oncogene_list: "/PATH_TO_REFERENCE/GRCh38/Annotations/OncoList_OncoKB_GRCh38_2025-07-04.tsv"
  GRCm39:
    fasta: "/PATH_TO_REFERENCE/GRCm39/Sequences/GRCm39.primary_assembly.genome.fa"
    index: "/PATH_TO_REFERENCE/GRCm39/Indexes/Bowtie2/GRCm39.primary_assembly.genome" 
    annotation: "/PATH_TO_REFERENCE/GRCm39/Annotations/gencode.vM36.annotation.gtf.gz"
    oncogene_list: ""

Reads filtering

After adaptor & ODN triming and before alignment to the reference genome, reads that are too short are discarded. This filter is applied if any of the mates size is below this threshold.

################################################
minLength: 25 ## Minimal read length after trimming, before alignment
################################################

Alignment to reference genome

Define which aligner to use and the range of fragment size.

## Alignement 
################################################
aligner: "bowtie2"   ## Aligner to use (bowtie2 only for now)
minFragLength: 100         # Minimal fragment length after alignment
maxFragLength: 1500        # Maximal fragment length after alignment 
rescue_R2: "TRUE" # keep R2 from unaligned pairs or pairs with too short R1 reads and align them as single-end reads.
################################################

Insertion sites calling

After alignment on the genome, R2 reads are collapsed to single insertion points and aggregated if they cluster in a distance smaller than ISbinWindow defined here. Filters can be applied to exclude UMI with few reads (minReadsPerUMI) or insertion sites with few UMIs (minUMIPerIS).

Here, you can also define if you want to tolerate bulges in the alignment between the gRNA and gDNA.

################################################
## Off targets calling
tolerate_bulges: "TRUE"           # whether to include gaps in the gRNA alignment (this will change the gap penalty during SW pairwise alignment)
max_edits_crRNA: 6                # filter clusters with less or equal than n edits in the crRNA sequence (edits = substitutions + INDELs)
ISbinWindow: 100                  # insertion sites closer than 'ISbinWindow' will be clustered together
minReadsPerUMI: 4                 # Min number of reads per UMIs (>=)
minUMIPerIS: 4                      # Min number of UMI per IS (>=)
slopSize: 50                      # window size (bp) around IS (both directions) to identify gRNA sequence (ie 50bp = -50bp to +50bp)
min_predicted_distance: 100       # distance between cut site and predicted cut site to consider as predicted
################################################

UMI correction

Due to potential sequencing errors, additional UMIs may be detected and a correction step is required.

For each cluster of Off Targets, a similarity matrix between all UMIs detected is calculated and similar UMI collapsed together if the editing distance is smaller than UMI_hamming_distance . The Adjacency method described in UMI-tools (@Smith2017) is used by default (see https://umi-tools.readthedocs.io/en/latest/the_methods.html for details).

################################################
# post alignment
minMAPQ: 20                      # Min MAPQ score to keep alignments 
UMI_hamming_distance: 1         # min distance to cluster UMI using network-based deduplication, use [0] to keep raw UMIs
UMI_deduplication: "Adjacency"  # method to correct UMI (cluster or Adjacency)
UMI_pattern: "NNWNNWNN"  
UMI_filter: "TRUE"              # If TRUE, remove UMIs that do no match the expected pattern [FALSE or TRUE]
################################################

Reporting

################################################
# reporting
max_clusters: 100                 # max number of cluster alignments to report
minUMI_alignments_figure: 1       # filter clusters with more than n UMI in the report alignment figure (set to 0 to keep all clusters -> can be slow)
################################################

Prediction

# Prediction
################################################
SWoffFinder:
  path: "/opt/SWOffinder" ## Path to SWoffinder on your server (downloaded from https://github.com/OrensteinLab/SWOffinder)
  maxE: 6                 # Max edits allowed (integer).
  maxM: 6                 # Max mismatches allowed without bulges (integer).
  maxMB: 6                # Max mismatches allowed with bulges (integer).
  maxB: 3                 # Max bulges allowed (integer).
  window_size: 100
################################################

Reads adapter & ODN trimming sequences

Indicate which sequence will be trimmed from R1 & R2 reads ends depending on the PCR orientation and ODN used.

################################################
# Sequences for the trimming steps

guideseq:
  positive:
    R1_trailing: "GTTTAATTGAGTTGTCATATGT"
    R2_leading: "ACATATGACAACTCAATTAAAC"
    R2_trailing: "AGATCGGAAGAGCGTCGTGT"
  negative:
    R1_trailing: "ATACCGTTATTAACATATGACAACTCAA"
    R2_leading: "TTGAGTTGTCATATGTTAATAACGGTAT"
    R2_trailing: "AGATCGGAAGAGCGTCGTGT"



iguideseq:
  positive:
    R2_leading: "ACATATGACAACTCAATTAAACGCGAGC"
    R2_trailing: "AGATCGGAAGAGCGTCGTGT"
    R1_trailing: "GCTCGCGTTTAATTGAGTTGTCATATGT"
  negative:
    R1_trailing: "TCGCGTATACCGTTATTAACATATGACAACTCAA"
    R2_leading: "TTGAGTTGTCATATGTTAATAACGGTATACGCGA"
    R2_trailing: "AGATCGGAAGAGCGTCGTGT"
    
    
    
olitagseq:
  positive:
    R1_trailing: "GGGGTTTAATTGAGTTGTCATATGTT"
    R2_leading: "AACATATGACAACTCAATTAAACCCC"
    R2_trailing: "TCCGCTCCCTCG"
  negative:
    R1_trailing: "CCCATACCGTTATTAACATATGAC"
    R2_leading: "GTCATATGTTAATAACGGTATGGG"
    R2_trailing: "TCCGCTCCCTCG"

tagseq:
  positive:
    R1_trailing: "TGCGATAACACGCATTTCGCATAA"
    R2_leading: "CTTATGCGAAATGCGTGTTATCGCA"
    R2_trailing: "AGATCGGAAGAGCGTCGTGT"
  negative:
    R1_trailing: "ATCTCTGAGCCTTATGCGAAATGC"
    R2_leading: "CGCATTTCGCATAAGGCTCAGAGAT"
    R2_trailing: "AGATCGGAAGAGCGTCGTGT"
    
################################################

Folder structure

In order to start a run:

  • create a new directory in the installation folder and cd into.

  • Then :

Input fastq files should respect the following structure from original paper :

  • R1 : contains fragment sequence starting in gDNA

  • R2: Starts with ODN sequence followed by gDNA sequence and potential trailing adaptor sequence

  • i1 : Contains barcode 1 (usually 8 nucleotides)

  • i2 : Contains barcode 2 and UMI sequence (usually 8 + 8 nucleotides)

Your folder architecture should look similar to :

Path/to/GENETHOFF/
├── 00-pipeline/
├── 01-envs/
├── 02-resources/
├── 03-misc/
├── test_dataset/
├── My/folder/
    ├── configuration.yml
    ├── sampleInfo.csv
    ├── undertermined_R1.fastq.gz
    ├── undertermined_R2.fastq.gz
    ├── undertermined_I1.fastq.gz
    └── undertermined_I2.fastq.gz

From inside your analysis folder, run the command below after adjusting for number of CPU (-j) :

snakemake -s ../00-pipeline/genethOFF.snakemake \
  -j 24 \
  -k \
  --use-conda \ 
  --report-after-run --report runtime_report.html  \
  -n
    
# remove the -n argument to start the pipeline

Each rule takes a maximum of 6 threads (alignment, trimming) to speed up the data processing. Set -j as a multiple of 6 to process 2 (12threads) , 3 (18 threads) … samples in parallel.

## usefull snakemake arguments 
# see https://snakemake.readthedocs.io/en/stable/executing/cli.html#all-options

--quiet
--notemp # keep all intermediate files
--rerun-trigger {code,input,mtime,params,software-env} 
--rerun-incomplete

 --filegraph | sed -n '/digraph/,$p' | dot -Tpdf > dag_files.pdf #DAG representation of workflow
 --rulegraph | sed -n '/digraph/,$p' | dot -Tpdf > dag_rules.pdf 

Output

If everything goes well, the pipeline should end successfully :

Workflow finished, no error
 _____________
< You rock baby !! >
 -------------
        \   ^__^
         \  (♥♥)\_______
            (__)\       )\/\
                ||----w |
                ||     ||

Otherwise, an error will be raised and the origine of the problem reported by snakemake:

< Houston, we have a problem >
 ----------------------------
       \   \_______
 v__v   \  \   O   )
 (xx)      ||----w |
 (__)      ||     ||  \/\

Upon pipeline completion & if 'clean_intermediates_files: 'FALSE', your folder should now look like (test dataset provided in ./test) :

my_folder_name/
├── 00-demultiplexing
├── 01-trimming
├── 02-filtering
│   ├── VEGFA_s1_K562_neg_R1.UMI.ODN.trimmed.filtered.fastq.gz
│   ├── VEGFA_s1_K562_neg_R2.UMI.ODN.trimmed.filtered.fastq.gz
│   ├── VEGFA_s1_K562_pos_R1.UMI.ODN.trimmed.filtered.fastq.gz
│   └── VEGFA_s1_K562_pos_R2.UMI.ODN.trimmed.filtered.fastq.gz
├── 03-align
│   ├── VEGFA_s1_K562_neg_R1.UMI.ODN.trimmed.unmapped.fastq.gz
│   ├── VEGFA_s1_K562_neg_R2rescued.UMI.ODN.trimmed.filtered.sorted.bam
│   ├── VEGFA_s1_K562_neg_R2rescued.UMI.ODN.trimmed.filtered.sorted.bam.bai
│   ├── VEGFA_s1_K562_neg_R2.UMI.ODN.trimmed.unmapped.fastq.gz
│   ├── VEGFA_s1_K562_neg.UMI.ODN.trimmed.filtered.sorted.filtered.bam
│   ├── VEGFA_s1_K562_neg.UMI.ODN.trimmed.filtered.sorted.filtered.bam.bai
│   ├── VEGFA_s1_K562_pos_R1.UMI.ODN.trimmed.unmapped.fastq.gz
│   ├── VEGFA_s1_K562_pos_R2rescued.UMI.ODN.trimmed.filtered.sorted.bam
│   ├── VEGFA_s1_K562_pos_R2rescued.UMI.ODN.trimmed.filtered.sorted.bam.bai
│   ├── VEGFA_s1_K562_pos_R2.UMI.ODN.trimmed.unmapped.fastq.gz
│   ├── VEGFA_s1_K562_pos.UMI.ODN.trimmed.filtered.sorted.filtered.bam
│   └── VEGFA_s1_K562_pos.UMI.ODN.trimmed.filtered.sorted.filtered.bam.bai
├── 04-IScalling
│   ├── VEGFA_s1_K562_neg.cluster_slop.bed
│   ├── VEGFA_s1_K562_neg.cluster_slop.fa
│   ├── VEGFA_s1_K562_neg_R2rescued.reads_per_UMI_per_IS.bed
│   ├── VEGFA_s1_K562_neg.reads_per_UMI_per_IS.bed
│   ├── VEGFA_s1_K562_neg.reads_per_UMI_per_IS_corrected.bed
│   ├── VEGFA_s1_K562_neg.UMIs_per_IS_in_Cluster.bed
│   ├── VEGFA_s1_K562_pos.cluster_slop.bed
│   ├── VEGFA_s1_K562_pos.cluster_slop.fa
│   ├── VEGFA_s1_K562_pos_R2rescued.reads_per_UMI_per_IS.bed
│   ├── VEGFA_s1_K562_pos.reads_per_UMI_per_IS.bed
│   ├── VEGFA_s1_K562_pos.reads_per_UMI_per_IS_corrected.bed
│   └── VEGFA_s1_K562_pos.UMIs_per_IS_in_Cluster.bed
├── 05-Report
│   ├── VEGFA_s1_K562_neg.rdata
│   ├── VEGFA_s1_K562_neg.stat
│   ├── VEGFA_s1_K562_pos.rdata
│   └── VEGFA_s1_K562_pos.stat
├── 06-offPredict
│   └── GRCh38_GGGTGGGGGGAGTTTGCTCC_NGG_3.csv
├── configuration.yml
├── logs
│   ├── demultiplexing_R1.log
│   ├── demultiplexing_R2.log
│   ├── VEGFA_s1_K562_neg.filter.log
│   ├── VEGFA_s1_K562_neg.odn.log
│   ├── VEGFA_s1_K562_neg_R2rescued.UMI.ODN.trimmed.filtered.align.log
│   ├── VEGFA_s1_K562_neg.trailing.log
│   ├── VEGFA_s1_K562_neg.UMI.log
│   ├── VEGFA_s1_K562_neg.UMI.ODN.trimmed.filtered.align.log
│   ├── VEGFA_s1_K562_pos.filter.log
│   ├── VEGFA_s1_K562_pos.odn.log
│   ├── VEGFA_s1_K562_pos_R2rescued.UMI.ODN.trimmed.filtered.align.log
│   ├── VEGFA_s1_K562_pos.trailing.log
│   ├── VEGFA_s1_K562_pos.UMI.log
│   └── VEGFA_s1_K562_pos.UMI.ODN.trimmed.filtered.align.log
├── results
│   ├── report-files
│   │   ├── VEGFA_s1_K562_neg_offtargets_dynamic_files
│   │   │   ├── .... truncated
│   │   ├── VEGFA_s1_K562_neg_offtargets_dynamic.html
│   │   ├── VEGFA_s1_K562_neg_offtargets.html
│   │   ├── VEGFA_s1_K562_pos_offtargets_dynamic_files
│   │   │   ├── .... truncated
│   │   ├── VEGFA_s1_K562_pos_offtargets_dynamic.html
│   │   └── VEGFA_s1_K562_pos_offtargets.html
│   ├── report.rdata
│   ├── test_report.html
│   ├── VEGFA_s1_K562_neg_summary.xlsx
│   └── VEGFA_s1_K562_pos_summary.xlsx
├── sampleInfo.csv
├── test_datasheet.csv
└── test_datasheet.xlsx

Report

A general report is generated. It summarizes all main QC and key features obtained from the run using graphical representations and tables.

An example is available in the ./test_dataset/results folder

Off-targets files

For each sample, an Excel file containing all the OT information is created. This file includes numerous columns, some of which are particularly noteworthy. It lists all detected positions, even those without any gRNA matches. For each position, the file reports the total number of UMIs and reads, providing the same information for both positive and negative PCRs. Insertion sites are annotated to genes and oncogenes if they are defined in the configuration file. For OT sites with gRNA matches, a summary of INDELS and mismatchs positions is also provided.

Here is the data formatted into a markdown table:

Index Header value Description
1 Chromosome Chromosome ID where cluster is located
2 Start_cluster Genomic coordinates of the cluster
3 end_cluster
4 ClusterID ID of cluster
5 MedianMAPQ_cluster Median of MAPQ score for alignments in the cluster [0, 42]
6 N_IS_cluster Number of unique cut positions in the cluster [1, +inf]
7 N_orientations_cluster Number of ODN integration orientation in the cluster [1, 2]
8 N_orientation_PCR Number of PCR orientation detected in the cluster [1, 2]
9 N_UMI_cluster Sum of UMIs for all sites in the cluster [1, +inf]
10 N_reads_cluster Sum of reads for all sites in the cluster [1, +Inf]
11 - 20 Same as 5-10, broken down by PCR orientation
21 Sequence_window Nucleotide sequence of the cluster
22 grna_orientation Strand the gRNA sequence is matched [Watson, crick]
23 Seq_gDNA Sequence of the gDNA matching the gRNA
24 Seq_gRNA Sequence of the gRNA
25 Alignment Pairwise alignment representation between gRNA and gDNA
26-27 Gibbs hybridization Efficacy and dG_0
28 GC_content GC% of the gDNA sequence matched
29 Alignment_score Alignment score for pairwise alignment of gRNA & gDNA
30 Identity_pct % identity between gRNA & gDNA sequences
31 N_edits Total number of Edit in the alignment (mismatches + indels)
32 mismatches_position_gRNA Position of mismatches in the gRNA
33 -
34 N_indels Number of indels in the pairwise alignment
35 Insertion_length Total length of insertions in the pairwise alignment
36 Start_insertion Start, end and width of each insertion in the pairwise alignment
37 End_insertion
38 Width_insertion
39 - 43 Start, end and width of each deletion in the pairwise alignment
44 Pam_gDNA PAM sequence identified in gDNA
45 Pam_gRNA Theoretical PAM sequence (sample datasheet)
46 Pam_side Which side is the PAM located (sample datasheet) [5, 3]
47 PAM_indel_count Number of indels in the PAM sequence
48 PAM_indel_pos Position of indels in the PAM sequence
49 Cut_gRNA_alignment Theoretical cut site from pairwise alignment and offset (sample datasheet)
50 Start_IS Genomic Position, abundance and relative abundance of the most abundant cut site in the cluster
51 Count_UMI
52 UMI_proportion
53 Cut_modal_position Cut site with the higher UMI counts in the cluster
54 gRNA gRNA sequence (sample datasheet)
55 gRNA_name gRNA name (sample datasheet)
56 Gene_ensemblID Gene ID, symbol, type and position (Intron, Exon) for intragenic cut sites
57 Symbol
58 Gene_type
59 Position
60 Onco_annotation Annotation with user defined oncogene
61 Best Is cluster the best candidate relative to number of edits
62 Relative_abundance Relative abundance of cluster among all clusters
63 Rank Rank of cluster (by decreasing relative abundance)
64 Predicted Was position predicted?
65 bulge If indels are present, do they form gRNA or gDNA bulge, or both

Pipeline step-by-step explanations

Demultiplexing

Tool : cutadapt

Undetermined fastq files are demultiplexed to sampleName fastq files according to barcodes present in the sample data sheet.

  • i1 and i2 fastq files are concatenated to a single fastq file (i3)

  • R1 and R2 fastq are demultiplexed according to i1+i2 sequence present in i3 fastq files.

ODN trimming:

Tool : cutadapt

The leading ODN sequence is remove from R2 reads according to the method defined in the sample data sheet for each sample.

Reads that do not start with the ODN sequence are discarded.

PCR orientation is automatically detected and added to read name for future processing:

@M02111:194:000000000-LT722:1:1101:15810:6788_positive

UMI extraction

Tool : cutadapt

UMI is extracted from the I3 read generate before based on UMI pattern length defined in the configuration file.

UMI is added to reads name:

@M02111:194:000000000-LT722:1:1101:15810:6788_positive_GCTGTAGG

Adaptor trimming:

Tool : cutadapt

The adaptor trailing sequences are trimmed from R1 and R2 reads respectively if present.

Read filtering:

Tool : cutadapt

After trimming, only read pairs with both mates longer than a minLength defined in the configuration file are selected for alignment.

If the rescue_R2 variable is set to TRUE, then R2 reads that are longer that minLength is a discrarded pair are rescued and processed as single-end reads.

Genome alignment:

Tools: Bowtie2

Reference sequences are specified in the configuration file. Genome index is build if it does not already exist.

Trimmed reads pairs that passed the filtering steps are then aligned on the reference genome specified in the sample data sheet for each sample using the aligner specified in configuration file.

Multi-hits management:

Multihits are reads with multiple possible equally good alignment positions in the genome. We choose to keep only a single random alignment for each read instead of reporting all possible positions.

Multihit alignments with low MAPQ score are discarded except if the Alignment score (AS tag) is equal to the score of the second best alignment score (XS tag) .

On the long run, if multi read arise from the same cuting site, they will distribute randomly to all sites (explain more).

Cutting site calling:

Tool : bedtools and awk

Following alignment on the reference genome, nuclease cutting sites are extracted from the start position of R2 read alignment.

Reads that align at the same cutting site with the same UMI are aggregated together keeping track of total reads count.

UMI correction:

Tool : R script

UMI sequences are corrected for potential sequencing error. UMI with less than n edits (hamming distance defined in the configuration file) are clustered together.

Cut site clustering:

Tool: bedtools

Cut sites than fall in the same window of ISbinWindow defined in the configuration file are clustered together.

gRNA match:

Tool: R script

For each cluster of cutting sites, the gRNA sequence defined in the sample data sheet for each sample is looked up in a window of +/- slopSize bp using the Swith-Watterman algorithm.

Gap tolerance can be accepted to detect bulges in gDNA or gRNA if the tolerate_bulges variable is set.

Annotation of clusters:

Tool : R script

Clusters of cutting sites are annotated using the gtf file specified in the configuration file for each organism.

A first step prepare the annotation file to extract only gene and exons features.

A second step annotate clusters to gene and position relative to those genes (exon/intron). Multiple annotations may be present for each cluster and are all reported.

Off target prediction:

Tool : SWOffinder

For each gRNA sequence, PAM sequence and each organism specified in the sample data sheet, a prediction of OTS is realized using the SWOffinder tool with edits and mismatches tolerance defined in the configuration file.

Reporting:

A report is generated with main tables and graphical representations to better understand pipeline results.

Troubleshooting

Potential issues :

Write permissions : In case of error, check that the user has read/write permission to the different reference/annotation files and working directory

Latex : If PDF report generation failed, check whether tinytex is correctly installed in R.

References